AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA ?

Monjur Alahi

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA ?
(1) AGGUAUCGCAU

(2) UGGTUTCGCAT

(3) ACCUAUGCGAU

(4) UCCAUAGCGUA


0 like 0 dislike
1 views
Share with your friends

2 Answers

Salim Ahmed Kawsar

Call

(1) AGGUAUCGCAU

Molecular Basis of Inheritance. ​

0 like 0 dislike
1 views
Talk Doctor Online in Bissoy App
Salim Ahmed Kawsar

Call

The correct option is(1) AGGUAUCGCAU

Explanation:

Coding strand is the one that codes for mRNA. It has same nucleotide sequence as that of mRNA except thymine (T) is replaced by uracil (U) in mRNA. Hence, the corresponding sequence of transcribed mRNA by template or non-coding strand (complementary to RNA) is AGGUAUCGCAU.

0 like 0 dislike
1 views
Talk Doctor Online in Bissoy App
If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3'

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC − 3’ Then, the sequence of complementary...

1 Answers 1 views
If the sequence of the coding strand in a transcription unit is written as

If the coding strand in a transcription unit is 5’− ATGCATGCATGCATGCATGCATGCATGC-3’ Then, it is known that the sequence of mRNA is same as the coding strand of DNA. However, in RNA, thymine is...

1 Answers 1 views
Differentiate between the followings: (a) Repetitive DNA and Satellite DNA (b) mRNA and tRNA (c) Template strand and Coding strand

(a) Repetitive DNA and satellite DNA satellite DNA Repetitive DNA Satellite DNA Repetitive DNA are DNA sequences that contain small segments, which are repeated many times. Satellite DNA are DNA sequences that contain highly...

1 Answers 1 views
Gene therapy is an attempt to correct a genetic defect by providing a normal gene into the individual.

Gene therapy would be a better option because it has the potential to completely cure the patient. It is because the correct gene once introduced in the patient, can continue...

1 Answers 1 views
You have identified a useful gene in a bacteria. Make a flow chart of the steps that you would follow to transfer this gene to a plant.

After identifying a useful gene in bacteria, following steps should be undertaken (1) Isolation of useful gene using Restriction Endonucleases                      ↓ (2) Transferring...

1 Answers 1 views
Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene?

Functional mRNA of structural genes need not always include all of its exons. This alternate splicing of exons is sex-specific, tissue-specific, and even developmental stage-specific. By such alternate splicing of exons, a...

1 Answers 1 views
If one strand of DNA has the sequence 5,-G-G-A-C-T-A-C-T-3",

3,-C-C-T-G-A-T-G-A-5"

1 Answers 1 views
In humans, the gene for black hair colour is B and gene for brown hair colour is b. What will be

(a) Black hair (b) Brown hair (c) Black hair (Hybrid)

1 Answers 1 views
If the sequence of nitrogen bases of the coding strand of DNA in a transcription unit is:

a. The sequence of bases in its RNA transcript would be 5' - A U G A A U G - 3'

1 Answers 1 views
If the base sequence of a codon in mRNA is 5'-AUG-3', the sequence of tRNA pairing with it must be:

b. The sequence of tRNA pairing with it must be 5' - CAU - 3'.

1 Answers 1 views
X